Description
The 2H3 monoclonal antibody specifically binds to human Fc receptor-like protein 6 (FCRL6), which is also known as Fc receptor homolog 6 (FcRH6), IFGP family protein 6 (IFGP6) or Immune receptor translocation-associated protein 6 (IRTA6). FCRL6 is a type I transmembrane glycoprotein of the Immunoglobulin (Ig) gene superfamily with 3 extracellular Ig domains. In healthy donors, FCRL6 is expressed by cytolytic CD8-positive T cells and NK cells; its expression is expanded to populations of CD4-positive T cells in HIV-1-positive patients. FCRL6 expression is associated with NK cell maturation. Human FCRL6 binds to HLA-DR, and it has a cytoplasmic immunoreceptor tyrosine-based inhibition motif (ITIM).
Put all BD AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
5. Illumina is a trademark of Illumina, Inc.
6. This product is covered by one or more of the following patents: US 8,835,358; US 9,290,808; US 9,290,809; US 9,315,857; US 9,567,645; US 9,567,646; US 9,598,736; US 9,708,659; and US 9,816,137. This product, and only in the amount purchased by buyer, may be used solely for buyer’s own internal research, in a manner consistent with the accompanying product literature. No other right to use, sell or otherwise transfer (a) this product, or (b) its components is hereby granted expressly, by implication or by estoppel. Diagnostic uses require a separate license.
7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
8. Please refer to bd.com/genomics-resources for technical protocols.
Specifications

General

BrandBD™ AbSeq
Alternative NameFc receptor-like protein 6; FcRH6; IFGP6; IgSF type I transmembrane receptor; fc receptor homolog 6; fcR-like protein 6
Entrez Gene ID343413
Vol. Per Test2 µl
IsotypeMouse BALB/c IgG2b, κ
ReactivityHuman (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceTGGTCAGATTGTCGATTTAGGCCGTTTGGTGTTAGG
Sequence IDAHS0256
ImmunogenHuman FCRL6 Transfected Cell Line
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesMouse