Description
The SK11 monoclonal antibody specifically binds to CD62L which is also known as, L-selectin, Leukocyte-endothelial cell adhesion molecule 1 (LECAM1/LECAM-1), Leukocyte adhesion molecule 1 (LAM1/LAM-1), Lymph node homing receptor (LNHR), Leu-8, or TQ1. CD62L is an ~80 kDa type I transmembrane glycoprotein that belongs to the Selectin/LECAM family. CD62L is differentially expressed on T cells, B cells, monocytes, granulocytes, and a subset of NK cells. The CD62L molecule is the human homolog of the mouse lymph node homing receptor, MEL-14. CD62L plays a role in leucocyte binding to inflamed endothelium and extravasation, as well as mediating lymphocyte homing into peripheral lymphoid tissues through high endothelial postcapillary venules. Soluble CD62L can result from the proteolytic cleavage of cell surface CD62L during cellular activation or inflammation.
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
5. Illumina is a trademark of Illumina, Inc.
6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
7. Please refer to bd.com/genomics-resources for technical protocols.
8. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NameL-selectin; LECAM-1; SELL; LNHR; LSEL; LAM-1; LEU8; PLNHR; TQ-1; MEL-14
Entrez Gene ID6402
Vol. Per Test2 µl
IsotypeMouse BALB/c IgG2a, κ
ReactivityHuman (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceGGCTGTATATTGCGGGTTAAAGTGGCTAGGATCGTT
Sequence IDAHS0265
ImmunogenHuman Peripheral Blood T Lymphocytes
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesMouse