Description
Reacts with CD16b, a glycosyl phosphatidyl inositol-anchored (GPI) protein expressed on human neutrophils. Human CD16 is the low affinity Fc gamma receptor III (Fc gamma RIII) and shows two distinct forms coded by two linked genes. One form is CD16a, a polypeptide-anchored form (Fc gamma RIIIA), present on natural killer cells and macrophages. The other form is CD16b the GPI-anchored form, Fc gamma RIIIB, found on human neutrophils. CD16b is polymorphic and the two codominant alleles are referred to as Neutrophil Antigen 1 (NA1) and Neutrophil Antigen 2 (NA2). Clone CLBgran11.5 reacts with neutrophils expressing the NA1 molecule. CD16b has been reported to participate in immune complex binding by resting neutrophils and also in neutrophil transendothelial migration by interacting with integrins during the inflammation response process.
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
5. Illumina is a trademark of Illumina, Inc.
6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
7. Please refer to bd.com/genomics-resources for technical protocols.
8. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NameFCGR3B; FCRIIIb; FcγIIIB
Entrez Gene ID2215
Vol. Per Test2 µl
IsotypeMouse BALB/c IgG2a, κ
ReactivityHuman (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceTATTGGGCTGCTAGTGTATTGACCGAAAGACGTATG
Sequence IDAHS0268
ImmunogenHuman Granulocytes
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesMouse
BD 940389 Oligo Mouse Anti-Human CD16b CLB-gran11.5 | IRIGHT