Description
The HMPV monoclonal antibody specifically binds to CD227 which is also known as Mucin-1 (MUC1). A major form of CD227 is expressed as a type I transmembrane glycoprotein. CD227 belongs to the epithelial mucin family whose members are heavily O-glycosylated and characterized by high molecular weight, and an amino acid composition rich in serine, threonine, proline, and glycine. CD227 is variably expressed on the surfaces of normal and malignant glandular and ductal epithelial cells, and some hematopoietic cell lineages including subsets of T cells, B cells, monocytes and dendritic cells. Soluble forms of CD227 may arise by shedding from the cell surface or by secretion of forms derived from alternative RNA splicing. The HMPV antibody binds to the core peptide of the MUC1 protein. The core protein contains a domain of 20 amino-acid tandem repeats which function as multiple epitopes for this monoclonal antibody. Incomplete glycosylation of some tumor-associated mucins may lead to variable unmasking of the multiple peptide epitopes leading to the observed differences in immunostaining intensities between cells from normal and malignant tissues. CD227 plays roles in the provision of protective barrier function, the regulation of cellular adhesion, and the transduction of multiple signal pathways.
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
5. Illumina is a trademark of Illumina, Inc.
6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
7. Please refer to bd.com/genomics-resources for technical protocols.
8. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NameMUC1; CA 15-3; DF3; EMA; Episialin; H23; H23AG; KL-6; MAM6; PEM; PEMT; PUM
Entrez Gene ID4582
Vol. Per Test2 µl
IsotypeMouse IgG1, κ
ReactivityHuman (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceTTGTGTTGACGCGGAATACGGTAAGTGCCAGAAGGT
Sequence IDAHS0270
ImmunogenHuman Milk Fat Globule Membranes
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesMouse
BD 940391 Oligo Mouse Anti-Human MUC1 (CD227) HMPV | IRIGHT