Description
The 15D3 monoclonal antibody specifically recognizes P-glycoprotein which is also known as CD243, ATP-binding cassette subfamily B member 1 (ABCB1) or Multidrug resistance protein 1 (MDR1). P-glycoprotein is a ~170 kDa transmembrane glycoprotein protein that spans the membrane 12 times. P-glycoprotein acts as an ATP-dependent efflux pump for a large variety of drugs. It may be expressed at high levels by multidrug resistant (MDR) tumor cells. This efflux activity may lead to cellular resistance to the drugs used in chemotherapy. P-glycoprotein is present in many normal cell types including endothelial, epithelial, or secretory cells, and might protect them from naturally occurring xenobiotics.
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
2. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
3. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
4. Illumina is a trademark of Illumina, Inc.
5. Please refer to bd.com/genomics-resources for technical protocols.
6. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
8. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NameABCB1; ABC20; CLCS; GP170; MDR1; P-GP; PGY1; pgp 170
Entrez Gene ID5243
Vol. Per Test2 µl
IsotypeMouse BALB/c IgG1, κ
ReactivityMouse (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceGATAGGCGTAGATTTGTTGTGATTCGGTTAAGTCCC
Sequence IDAHS2146
ImmunogenMDR1-transfected BATV.2 cells
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesMouse