Description
The 6F12 antibody reacts with a 7-transmembrane-domain protein, which is similar to the F4/80 macrophage antigen of the EGF-TM7 protein family and is encoded by the Emr4 gene. The FIRE protein is expressed on myeloid cells with a denditic cell (DC) developmental potential, including subsets of DC and macrophages in the spleen and lymph nodes, most resident peritoneal macrophages, many peripheral blood monocytes, and a subpopulation of bone-marrow myeloid-cell progenitors. The protein is not detected on peripheral T and B lymphocytes, and it is down-regulated on thioglycollate-elicited peritoneal macrophages and on dendritic cells activated by GM-CSF, IFN-γ, anti-CD40, and LPS. Using soluble biotinylated fusion protein, a FIRE ligand was detected on a mouse IgG+ B lymphoma cell line (A20), but not on myeloid, fibroblast, or T-cell lines, suggesting that the FIRE protein may be involved in immunoregulatory interactions between antigen-presenting cells and B lymphocytes.
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
5. Illumina is a trademark of Illumina, Inc.
6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
7. Please refer to bd.com/genomics-resources for technical protocols.
8. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NameFire; Emr4; EGF-like module receptor 4; D17Ertd479e; Egf-tm7
Entrez Gene ID52614
Vol. Per Test2 µl
IsotypeRat IgG2a, κ
ReactivityMouse (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceTGAATGGTTGAGGTTGCGGATAAGGTACTAAGCTGG
Sequence IDAMM2159
ImmunogenCHO cells expressing recombinant FIRE fusion protein
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesRat
BD 940412 Oligo Rat Anti-Mouse F4/80-Like Receptor 6F12.1 | IRIGHT