Description
The M-A251 monoclonal antibody specifically binds to the 55 kDa type I transmembrane glycoprotein known as low-affinity interleukin-2 receptor alpha chain subunit (IL-2Rα). CD25 is expressed on regulatory T cells, activated lymphocytes (T and B), and monocytes. It associates with the IL-2Rβ/CD122 and IL-2Rγ/CD132 receptor chains to form the high-affinity IL-2R complex. CD25 expression on T and B lymphocytes is upregulated by antigenic or mitogenic stimulation. Soluble CD25/IL-2Rα is produced as a consequence of lymphocyte stimulation and is found in biological fluids following inflammatory responses.
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
5. Illumina is a trademark of Illumina, Inc.
6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
7. Please refer to bd.com/genomics-resources for technical protocols.
8. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NameIL-2R; IL2RA; IL-2Rα; TCGFR; TAC antigen; p55
Entrez Gene ID3559
Vol. Per Test2 µl
IsotypeMouse BALB/c IgG1, κ
ReactivityHuman (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceGATTTGGTCGGGTCTGATACTATGCGGTTGGTCGTT
Sequence IDAHS0166
ImmunogenPhytohemagglutinin stimulated human lymphocytes
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesMouse