Description
The R19-760 monoclonal antibody specifically binds to NCAM-1 (Neural cell adhesion molecule 1) that is also known as CD56 and NKH1. NCAM-1 is a heavily glycosylated transmembrane protein and a member of the Ig supergene family. NCAM-1 represents an isoform of the neural cell adhesion molecule (NCAM). In the hematopoietic system, it is present on approximately 10% to 25% of peripheral blood lymphocytes. It is expressed on natural killer (NK) cells and a subset of T cells, NKT cells. It is not expressed on myeloid cells, erythrocytes or B cells. This molecule appears to function as an adhesion molecule and can serve as a panspecific NK-cell marker. The R19-760 antibody recognizes an epitope in the NCAM-1 (CD56) extracellular domain that resists destruction due to cellular fixation with BD Phosflow™ Lyse/Fix Buffer and permeabilization with BD Phosflow™ Perm Buffer III.
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
5. Illumina is a trademark of Illumina, Inc.
6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
7. Please refer to bd.com/genomics-resources for technical protocols.
8. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NameN-CAM-1, Neural cell adhesion molecule 1; NKH1; MSK39; Leu-19
Entrez Gene ID4684
Vol. Per Test2 µl
IsotypeMouse IgG1, κ
ReactivityHuman (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceTGTTTGGCGTGTATGTCTTGTCGTCGAGGTGGAATT
Sequence IDAHS0240
ImmunogenHuman NCAM1 Recombinant Protein
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesMouse