Description
CD244 is a type I transmembrane glycoprotein that is also known as Natural killer cell receptor 2B4 (NKR2B4), or Signaling lymphocytic activation molecule 4 (SLAMF4). CD244 is a member of the CD2 subset of the immunoglobulin superfamily (CD2 IgSF). It is expressed on all natural killer (NK) cells, IL-2-activated NK (LAK) cells, committed progenitors of NK cells, and a subset of T lymphocytes which mediate non-MHC-restricted cytoxicity, including dendritic epidermal T cells. The 2B4 monoclonal antibody specifically binds to CD244.2, the 2B4 alloantigen which is expressed on C57BL/6 and C58/J mice, but not in most strains tested (A/J, AKR, BALB/c, CBA/J, CBA/N, C3H/He, C57BR, DBA/1, DBA/2, NZB, SJL/J, 129). At least two isoforms of CD244.2 protein, products of alternative splicing of hnRNA, are expressed on IL-2-activated C57BL/6 NK cells. They differ only in their cytoplasmic domains; with 2B4L (150-aa cytoplasmic tail) having inhibitory activity and 2B4S (93-aa tail) being stimulatory. The extracellular domain of CD244 is a ligand for another CD2 IgSF member, CD48. 2B4 antibody activates lytic and secretory functions of IL-2-cultured NK cells and CD244.2+ T cells.
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
5. Illumina is a trademark of Illumina, Inc.
6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
7. Please refer to bd.com/genomics-resources for technical protocols.
8. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NameCD242.2; 2B4 B6 Alloantigen; Ly90; NAIL; Nmrk; SLAMF4
Entrez Gene ID18106
Vol. Per Test2 µl
IsotypeMouse 129, also known as 129/J or 129/SvJ IgG2b, κ
ReactivityMouse (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceACGATCAGGACGAATAGGTAGGTGGAGCATAATAGC
Sequence IDAMM2161
ImmunogenrIL-2-propagated NK1.1+ cells from C57BL/6 mice
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesMouse
BD 940474 Oligo Mouse Anti-Mouse CD244.2 2B4 | IRIGHT