Description
The BMA-12 monoclonal antibody specifically binds to CD100 which is also known as, Semaphorin-4D (Sema4D), or Collapsin-4 (Coll-4). CD100 is a ~150 kDa type I transmembrane glycoprotein that belongs to the class IV Semaphorin subfamily within the Ig gene superfamily. CD100 is expressed by cells from a broad range of tissues including the nervous system, where it serves in axon guidance and synapse formation, and the kidney. It is expressed by most hematopoietic cells including T cells which express CD100 more abundantly than B cells and dendritic cell subsets. Its expression is significantly upregulated upon activation of these cell types. CD100 can costimulate T cell responses. For B cells and dendritic cells, CD100 interaction with its ligands, CD72 or Plexin B1, induces cellular activation and promotes survival, respectively. CD100 is also known to interact with Plexin B2 on skin gamma delta T cells and contribute to the repair of tissue damage caused by inflammation. A biologically-active, soluble form of CD100 is generated by proteolytic cleavage of the cell surface form.
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
5. Illumina is a trademark of Illumina, Inc.
6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
7. Please refer to bd.com/genomics-resources for technical protocols.
8. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NameSemaphorin-4D; SEM4D; Semaphorin-C-like 2; Semacl2; Semaj; M-Sema G; coll-4
Entrez Gene ID20354
Vol. Per Test2 µl
IsotypeRat IgG2a, λ
ReactivityMouse (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceGTCGGGATTGTCTGTGTACGGTAGCATTGATTTAGT
Sequence IDAMM2245
ImmunogenMouse CD100 Recombinant Protein
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesRat