Description
The M3/84 monoclonal antibody specifically binds to CD107b which is also known as Mac-3, Lysosome-associated membrane protein 2 (LAMP-2/Lamp2/Lamp II), and Lysosomal membrane glycoprotein type B (LGP-B). CD107b is a single-pass type I transmembrane glycoprotein that constitutes a major integral membrane protein of lysosomes and may play a role in lysosomal function. CD107b is also expressed on the surface of mouse mononuclear phagocytes. Surface expression of the 92-110-kDa glycoprotein antigen increases during differentiation of monocytes to activated macrophages and may play a role in adhesion. The M3/84 mAb can detect CD107b antigen on tissue macrophages, thioglycollate-elicited peritoneal macrophages, and some myeloid cell lines, but not on lymphocytes or monocytes. In the bone marrow, very few cells display CD107b antigen on the surface, but a large proportion express cytoplasmic CD107b. The M3/84 antibody has also been reported to stain dendritic cells and endothelium in sections of thymus (both medulla and cortex), lymph nodes, spleen (white pulp), and gut-associated lymphoid tissue.
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
5. Illumina is a trademark of Illumina, Inc.
6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
7. Please refer to bd.com/genomics-resources for technical protocols.
8. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NameMac-3; Lamp2; LAMP-2; Lysosome-associated membrane glycoprotein 2; LGP-B
Entrez Gene ID16784
Vol. Per Test2 µl
IsotypeRat LEW x BN IgG1, κ
ReactivityMouse (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceTATTACGACGTTGGGTGTTATTGGGACTATGATGGC
Sequence IDAMM2246
ImmunogenMouse C57Bl/6 peritoneal exudate cells
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesRat