Description
The 8A-1 monoclonal antibody specifically binds to CD148, which is also known as Protein tyrosine phosphatase receptor type J (Ptprj), Receptor-type tyrosine-protein phosphatase eta (R-PTP-eta, PTPη), or Density-enhanced phosphatase-1 (DEP-1). CD148 is a receptor-like tyrosine phosphatase that plays important roles in regulating cell growth, proliferation, differentiation, adhesion, and migration. It is expressed on a wide variety of cell types including epithelial cells, endothelial cells, and fibroblasts. For cells of hemopoietic origin, it is variably expressed on macrophages, neutrophils, dendritic cells, and on developing and mature B cells. CD148 is expressed on platelets and can regulate platelet activation. Although expressed at low levels on thymocytes and mature T cells, its expression is upregulated upon T cell receptor (TCR)-mediated stimulation and may play a role in regulating TCR signaling. CD148, along with CD45, are critical protein tyrosine phosphatases for regulating Src family kinase signaling networks in immune cells.
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
5. Illumina is a trademark of Illumina, Inc.
6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
7. Although hamster immunoglobulin isotypes have not been well defined, BD Biosciences Pharmingen has grouped Armenian and Syrian hamster IgG monoclonal antibodies according to their reactivity with a panel of mouse anti-hamster IgG mAbs. A table of the hamster IgG groups, Reactivity of Mouse Anti-Hamster Ig mAbs, may be viewed at http://www.bdbiosciences.com/documents/hamster_chart_11x17.pdf.
8. Please refer to bd.com/genomics-resources for technical protocols.
9. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NamePtprj; R-PTP-J; BET; Byp; DEP-1; PTPbeta2; Ptpb2; R-PTP-eta; Scc-1; Scc1
Entrez Gene ID19271
Vol. Per Test2 µl
IsotypeSyrian Hamster IgG1
ReactivityMouse (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceTGTGGTGGGAGCGATTCAGTATGGCGTCTTAGGATT
Sequence IDAMM2249
ImmunogenMouse CD148 Transfected Cell Line
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesSyrian Hamster