Description
The 9A1.5 monoclonal antibody specifically binds to an extracellular domain of Delta-Like Protein 4 that is encoded by the Dll4 gene. Delta-Like Protein 4 is a type 1 transmembrane glycoprotein that is also known as Delta-like 4, Delta-like Ligand 4, Delta4 and DL4. It is a member of the Delta/Serrate/Jagged Family of Notch ligands. Notch ligands are classified by the presence of specific structural motifs including an N-terminal Delta-Serrate-LAG-2 (DSL) domain necessary for Notch binding, EGF repeats, and the DOS domain (a specialized EGF repeat). The Notch family of transmembrane receptors and their ligands control cell-fate "decisions" during the development of many organs in a wide variety of animal species. Delta-Like Protein 4 activates cellular signaling pathways by binding to Notch1 and Notch4 receptors. It is involved in embryonic vascular development and tumor angiogenesis, and is induced by vascular endothelial growth factor (VEGF)-A and hypoxia. Delta-Like Protein 4 and Notch receptor signaling are also intimately involved in the regulation of innate and adaptive immunity. Delta-Like Protein 4 is highly expressed by cortical thymic epithelial cells (TEC). Interaction between Delta-Like Protein 4-positive TEC and Notch1 expressed by T cell precursors drives T cell lineage commitment, expansion and maturation within the thymus. Delta-Like Protein 4 is also expressed by dendritic cells and plays a role in peripheral T helper cell differentiation. Blocking of Delta-Like Protein 4 and Notch receptor interactions serves to diminish autoimmune diseases in mouse model systems.
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
2. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
3. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
4. Illumina is a trademark of Illumina, Inc.
5. Please refer to bd.com/genomics-resources for technical protocols.
6. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
8. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NameDelta like-4; Delta4; Dll4; DL4; DL-4
Entrez Gene ID54485
Vol. Per Test2 µl
IsotypeRat LOU, also known as Louvain, LOU/C, LOU/M IgG1, κ
ReactivityMouse (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceGGATAGAGGTGTAGTGAATAATGGATAGTCGGCAGT
Sequence IDAMM2262
ImmunogenMouse DL4 Extracellular Domain Recombinant Protein
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesRat
BD 940493 Oligo Rat Anti-Mouse Delta-Like Protein 4 9A1.5 | IRIGHT