Description
The 17F9 monoclonal antibody specifically binds to the 170-180 kDa transmembrane glycoprotein (P-glycoprotein), a product of the multidrug resistance-1 (MDR1) gene. This glycoprotein is expressed on MDR positive cells and has been reported to be expressed on many normal tissues, such as adrenal glands and endothelium, in the brain and skin. P-glycoprotein is known to impart drug resistance to cells by pumping many anti-cancer drugs out of the cytoplasm. 17F9 antibody is able to partially block the binding of UIC2 antibody (another MDR-specific monoclonal antibody).
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
2. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
3. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
4. Illumina is a trademark of Illumina, Inc.
5. Please refer to bd.com/genomics-resources for technical protocols.
6. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
8. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NameCD243; ABCB1; ABC20; CLCS; GP170; MDR1; P-GP; PGY1
Entrez Gene ID5243
Vol. Per Test2 µl
IsotypeMouse BALB/c IgG2b, κ
ReactivityHuman (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceGATAATAGGGCGGATGAGAATGCGTAAGTTGAAGCT
Sequence IDAHS0250
ImmunogenHuman MDR1 Transfected Cell Line
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesMouse
BD 940503 Oligo Mouse Anti-Human P-glycoprotein (CD243) 17F9 | IRIGHT