Description
The Cy34.1 monoclonal antibody specifically binds to the B-lymphocyte differentiation antigen CD22 on strains having the Lyb-8.2 alloantigen (e.g., A, BALB/c, CBA, C3H/He, C57BL, C57L, C58, SJL, SWR, but not AKR, DBA/1, DBA/2, NZB, PL). CD22 is expressed at high levels on mature peripheral B lymphocytes (follicular and marginal zone), B-1 cells (CD5+ B cells), and plasma cells. It is a member of the Ig gene superfamily and associates with the B-cell antigen receptor. Its sialic acid- binding immunoglobulin-like lectin (siglec) extracellular region mediates B-cell adhesion to ligands on endothelial cells in the bone marrow. Its intracellular domain is phosphorylated after cross-linking of antigen receptor or MHC class II antigen. It is involved in negative regulation of B-cell activation and protection from autoimmunity. B-cell proliferative responses to LPS or anti-mouse Ig µ chain are augmented in the presence of Cy34.1 mAb.
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
2. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
3. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
4. Illumina is a trademark of Illumina, Inc.
5. Please refer to bd.com/genomics-resources for technical protocols.
6. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
8. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NameLyb8.2; Lyb-8.2; BL-CAM; Siglec-2
Entrez Gene ID12483
Vol. Per Test2 µl
IsotypeMouse DBA/1 IgG1, κ
ReactivityMouse (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceCATGGTTGTTTGAGCGCGAATTGTAGTTGAAGGTTG
Sequence IDAMM2252
ImmunogenB10.D2 mouse splenocytes
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesMouse
BD 940505 Oligo Mouse Anti-Mouse CD22.2 Cy34.1 | IRIGHT