Description
The C92-605.rMAb is a recombinant monoclonal antibody derived from C92-605 hybridoma cells. This antibody specifically recognizes the active form of Caspase-3 in human and mouse cells. It has not been reported to recognize the pro-enzyme form of Caspase-3. The Caspase family of cysteine proteases play crucial roles in apoptosis and inflammation. Caspase-3 is a key protease that is activated during the early stages of apoptosis and, like other members of the Caspase family, is synthesized as an inactive pro-enzyme that is processed in cells undergoing apoptosis by self-proteolysis and/or cleavage by another protease. The processed forms of caspases consist of large (17-22 kDa) and small (10-12 kDa) subunits which associate to form an active enzyme. Active Caspase-3, a marker for cells undergoing apoptosis, consists of a heterodimer of 17 and 12 kDa subunits which is derived from the 32 kDa pro-enzyme. Active Caspase-3 proteolytically cleaves and activates other caspases, as well as relevant targets in the cytoplasm, eg, D4-GDI and Bcl-2, and in the nucleus (eg, PARP).
Put all BD® AbSeq reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for = 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening. When using BD® AbSeq intracellular markers with the Single Cell 3' Sequencing Intracellular CITE-seq, cells must first be fixed and permeabilized using the BD Rhapsody™ Intracellular AbSeq Buffer Kit before the antibody-oligo can bind to the protein. Refer to the list of required companion products below and see BD Rhapsody™ System Single-Cell Labelling with BD® AbSeq Ab-Oligos for Intracellular CITE-seq (Doc ID: 23-24464) for the complete BD® AbSeq intracellular multiomics staining protocol. Contact your local Field Application Specialist (FAS) for additional guidance. Use standard laboratory safety protocols. Read and understand the safety data sheets (SDSs) before handling chemicals. To obtain SDSs, go to regdocs.bd.com or contact BD Biosciences technical support at [email protected]. Warning: All biological specimens and materials contacting them are considered biohazardous. Handle as if capable of transmitting infection and dispose of with proper precautions in accordance with federal, state, and local regulations. Never pipette by mouth. Wear suitable protective clothing, eyewear, and gloves.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. Please refer to www.bdbiosciences.com/us/s/resources for technical protocols.
2. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
6. Species cross-reactivity detected in product development may not have been confirmed on every format and/or application.
7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
8. Please refer to bd.com/genomics-resources for technical protocols.
9. Illumina is a trademark of Illumina, Inc.
10. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD® AbSeq
Alternative NameApopain; CASP-3; CASP3; CC3; CPP-32; CPP32; Caspase 3; Yama
Entrez Gene ID836, 12367
Vol. Per Test2 µl/test
IsotypeRabbit IgG, κ
ReactivityHuman, Mouse (Tested in Development)
Barcode SequenceAGAAGGGCTATTGACGACGTGATGTGAGTGTTATGT
Sequence IDAHS477
ImmunogenHuman Active Caspase-3 Fragment
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesRabbit