Biolegend, 356937, TotalSeq™-A0144 anti-human CD185 (CXCR5) Antibody
10microg
Catalog Number: 356937
Request a quote.
Category
Manufacturer's Pagewww.biolegend.com/en-us/products/totalseq-a0144-anti-human-cd185-cxcr5-antibody-16330
| Verified Reactivity | Human |
|---|---|
| Antibody Type | Monoclonal |
| Host Species | Mouse |
| Immunogen | Human CXCR5-transfected cells |
| Formulation | Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA |
| Preparation | The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions. |
| Concentration | 0.5 mg/ml |
| Storage & Handling | The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze. |
| Application | PG - Quality tested |
| Recommended Usage | Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. |
| Additional Product Notes | TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq. The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Scientific Poster Library. |
|---|
| Product Citations | Leader AM, et al. 2021. Cancer Cell. 39:1594. PubMed Swanson E, et al. 2021. eLife. 10:00. PubMed Hao Y, et al. 2021. Cell. 184:3573. PubMed |
|---|
| RRID | AB_2750356 (BioLegend Cat. No. 356937) |
|---|
| Structure | G-protein coupled receptor, 7 transmembrane regions, 42 kD |
|---|
| Distribution | Mature B cells, Follicular helper T cells, and Burkitt's lymphoma cells. |
|---|
| Function | Mediates cell migration to the B cell follicles in the secondary lymphoid organs |
|---|
| Ligand/Receptor | CXCL13 |
|---|
| Cell Type | B cells, Tfh |
|---|
| Biology Area | Cell Biology, Immunology, Neuroinflammation, Neuroscience |
|---|
| Molecular Family | CD Molecules, Cytokine/Chemokine Receptors, GPCR |
|---|
| Antigen References | 1. Ma CS, et al. 2012. J. Exp. Med. 209:1241. 2. León B, et al. 2012. Nat. Immunol. 13:681. 3. Crotty S. 2011. Annu. Rev. Immunol. 29:621. 4. Kerfoot SM, et al. 2011. Immunity 34:947. 5. Sáez de Guinoa J, et al. 2011. Blood 118:1560. |
|---|
| Gene ID | 643 |
|---|
| UniProt | View information about CD185 on UniProt.org |
|---|
| Clone | J252D4 |
|---|
| Regulatory Status | RUO |
|---|
| Other Names | BLR1, MDR15 |
|---|
| Isotype | Mouse IgG1, κ |
|---|
| Barcode Sequence | AATTCAACCGTCGCC |
|---|